| Basic information from miRBase |
| hairpin accession number: MI0004745 |
| Located between position 110812687 and 110812771 on chromosome 2 strand + |
| Overlapping with sense strand of CTDSP1 (intron 4). |
| (Ensemble: ENSBTAT00000011010) |
| mature miRNAs for MI0004745: |
| bta-miR-26b (MIMAT0003531): TTCAAGTAATTCAGGATAGGTT |
| You can find this miRNA in ENTREZGENE: MIR26B (accession: 790985) |
| References |
| [1]Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP, Physiol Genomics. 29:35-43(2007)., "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" |
| [2]Long JE, Chen HX, Biochem Genet. 47:329-343(2009)., "Identification and characteristics of cattle microRNAs by homology searching and small RNA cloning" |