| Basic information from miRBase |
| hairpin accession number: MI0015949 |
| Located between position 11464097 and 11464186 on chromosome 22 strand - |
| Overlapping with antisense strand of CTDSPL (intron 4). |
| (Ensemble: ENSBTAT00000017828) |
| mature miRNAs for MI0015949: |
| bta-miR-26c (MIMAT0016938): AGCCTATCCTGGATTACTTGAA |
| You can find this miRNA in ENTREZGENE: MIR3603 (accession: 100498843) |
| References |
| [1]Hossain MM, Ghanem N, Hoelker M, Rings F, Phatsara C, Tholen E, Schellander K, Tesfaye D, BMC Genomics. 10:443(2009)., "Identification and characterization of miRNAs expressed in the bovine ovary" |