miRNEST 2.0, an integrative microRNA resource

miRNEST 2.0, an integrative microRNA resource :: Browse

Basic information from miRBase

hairpin accession number: MI0010464

Located between position 97827186 and 97827266 on chromosome 4 strand -

mature miRNAs for MI0010464:

bta-miR-29b (MIMAT0003828): TAGCACCATTTGAAATCAGTGTT

You can find this miRNA in ENTREZGENE: MIR29B-1 (accession: 100313105)

References

[1]Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP, Physiol Genomics. 29:35-43(2007)., "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues"

[2]Tesfaye D, Worku D, Rings F, Phatsara C, Tholen E, Schellander K, Hoelker M, Mol Reprod Dev. 76:665-677(2009)., "Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach"

[3]Strozzi F, Mazza R, Malinverni R, Williams JL, Anim Genet. 40:125(2009)., "Annotation of 390 bovine miRNA genes by sequence similarity with other species"

[4]Jin W, Grant JR, Stothard P, Moore SS, Guan LL, BMC Mol Biol. 10:90(2009)., "Characterization of bovine miRNAs by sequencing and bioinformatics analysis"