| Basic information from miRBase |
| hairpin accession number: MI0009788 |
| Located between position 73970390 and 73970477 on chromosome 16 strand + |
| Overlapping with antisense strand of A6QNU3_BOVIN (intron 1). |
| (Ensemble: ENSBTAT00000007107) |
| mature miRNAs for MI0009788: |
| bta-miR-29d (MIMAT0009275): TAGCACCATTTGAAATCGATTA |
| You can find this miRNA in ENTREZGENE: MIR29D (accession: 100313025) |
| References |
| [1]Strozzi F, Mazza R, Malinverni R, Williams JL, Anim Genet. 40:125(2009)., "Annotation of 390 bovine miRNA genes by sequence similarity with other species" |
| [2]Jin W, Grant JR, Stothard P, Moore SS, Guan LL, BMC Mol Biol. 10:90(2009)., "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" |