| Basic information from miRBase |
| hairpin accession number: MI0014498 |
| Located between position 21829420 and 21829516 on chromosome X strand - |
| Overlapping with sense strand of GABRE (intron 5). |
| (Ensemble: ENSBTAT00000018017) |
| mature miRNAs for MI0014498: |
| bta-miR-3431 (MIMAT0017394): CCTCAGTCAGCCTTGTGGATGT |
| You can find this miRNA in ENTREZGENE: MIR3431 (accession: 100526412) |
| References |
| [1]Jin W, Grant JR, Stothard P, Moore SS, Guan LL, BMC Mol Biol. 10:90(2009)., "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" |
| [2]Jin W, Dodson MV, Moore SS, Basarab JA, Guan LL, BMC Mol Biol. 11:29(2010)., "Characterization of microRNA expression in bovine adipose tissues: a potential regulatory mechanism of subcutaneous adipose tissue development" |