| Basic information from miRBase |
| hairpin accession number: MI0014500 |
| Located between position 55700328 and 55700424 on chromosome 21 strand - |
| Overlapping with sense strand of (intron 3). |
| (Ensemble: ENSBTAT00000028388) |
| mature miRNAs for MI0014500: |
| bta-miR-3432 (MIMAT0017396): TGCGGGATCTTTAGTTGTGGTG |
| You can find this miRNA in ENTREZGENE: MIR3432-1 (accession: 100526414) |
| References |
| [1]Jin W, Grant JR, Stothard P, Moore SS, Guan LL, BMC Mol Biol. 10:90(2009)., "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" |
| [2]Jin W, Dodson MV, Moore SS, Basarab JA, Guan LL, BMC Mol Biol. 11:29(2010)., "Characterization of microRNA expression in bovine adipose tissues: a potential regulatory mechanism of subcutaneous adipose tissue development" |