miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0014501
Located between position 35972410 and 35972506 on chromosome 25 strand -
Overlapping with sense strand of HIP1 (intron 19).
(Ensemble: ENSBTAT00000001039)
mature miRNAs for MI0014501:
         bta-miR-3432 (MIMAT0017396): TGCGGGATCTTTAGTTGTGGTG
You can find this miRNA in ENTREZGENE: MIR3432-2 (accession: 100526415)

References
[1]Jin W, Grant JR, Stothard P, Moore SS, Guan LL, BMC Mol Biol. 10:90(2009)., "Characterization of bovine miRNAs by sequencing and bioinformatics analysis"
[2]Jin W, Dodson MV, Moore SS, Basarab JA, Guan LL, BMC Mol Biol. 11:29(2010)., "Characterization of microRNA expression in bovine adipose tissues: a potential regulatory mechanism of subcutaneous adipose tissue development"