| Basic information from miRBase |
| hairpin accession number: MI0015950 |
| Located between position 13733556 and 13733633 on chromosome 7 strand + |
| Overlapping with sense strand of DYN2_BOVIN (intron 14). |
| (Ensemble: ENSBTAT00000036123) |
| mature miRNAs for MI0015950: |
| bta-miR-3604 (MIMAT0016939): TAACCAATGTGCAGACTACTGT |
| You can find this miRNA in ENTREZGENE: MIR3604-1 (accession: 100498836) |
| References |
| [1]Hossain MM, Ghanem N, Hoelker M, Rings F, Phatsara C, Tholen E, Schellander K, Tesfaye D, BMC Genomics. 10:443(2009)., "Identification and characterization of miRNAs expressed in the bovine ovary" |