| Basic information from miRBase |
| hairpin accession number: MI0015951 |
| Located between position 102419020 and 102419092 on chromosome 11 strand + |
| Overlapping with sense strand of DYN1_BOVIN (intron 15). |
| (Ensemble: ENSBTAT00000032743) |
| mature miRNAs for MI0015951: |
| bta-miR-3604 (MIMAT0016939): TAACCAATGTGCAGACTACTGT |
| You can find this miRNA in ENTREZGENE: MIR3604-2 (accession: 100498853) |
| References |
| [1]Hossain MM, Ghanem N, Hoelker M, Rings F, Phatsara C, Tholen E, Schellander K, Tesfaye D, BMC Genomics. 10:443(2009)., "Identification and characterization of miRNAs expressed in the bovine ovary" |