| Basic information from miRBase |
| hairpin accession number: MI0010444 |
| Located between position 66017932 and 66018024 on chromosome 21 strand + |
| mature miRNAs for MI0010444: |
| bta-miR-376b (MIMAT0009945): ATCATAGAGGAAAATCCATGTT |
| You can find this miRNA in ENTREZGENE: MIR376B (accession: 100313394) |
| References |
| [1]Artzi S, Kiezun A, Shomron N, BMC Bioinformatics. 9:39(2008)., "miRNAminer: a tool for homologous microRNA gene search" |
| [2]Jin W, Grant JR, Stothard P, Moore SS, Guan LL, BMC Mol Biol. 10:90(2009)., "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" |