miRNEST 2.0, an integrative microRNA resource

miRNEST 2.0, an integrative microRNA resource :: Browse

Basic information from miRBase

hairpin accession number: MI0009819

Located between position 60536470 and 60536535 on chromosome 7 strand +

Overlapping with sense strand of (intron 1).

(Ensemble: ENSBTAT00000017197)

mature miRNAs for MI0009819:

bta-miR-378 (MIMAT0009305): ACTGGACTTGGAGTCAGAAGGC

You can find this miRNA in ENTREZGENE: MIR378 (accession: 100313042)

References

[1]Artzi S, Kiezun A, Shomron N, BMC Bioinformatics. 9:39(2008)., "miRNAminer: a tool for homologous microRNA gene search"

[2]Strozzi F, Mazza R, Malinverni R, Williams JL, Anim Genet. 40:125(2009)., "Annotation of 390 bovine miRNA genes by sequence similarity with other species"

[3]Tesfaye D, Worku D, Rings F, Phatsara C, Tholen E, Schellander K, Hoelker M, Mol Reprod Dev. 76:665-677(2009)., "Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach"

[4]Jin W, Grant JR, Stothard P, Moore SS, Guan LL, BMC Mol Biol. 10:90(2009)., "Characterization of bovine miRNAs by sequencing and bioinformatics analysis"