| Basic information from miRBase |
| hairpin accession number: MI0013052 |
| Located between position 11116890 and 11116965 on chromosome 4 strand + |
| Overlapping with antisense strand of Q29RL4_BOVIN (intron 2). |
| (Ensemble: ENSBTAT00000023201) |
| mature miRNAs for MI0013052: |
| bta-miR-378 (MIMAT0009305): ACTGGACTTGGAGTCAGAAGGC |
| You can find this miRNA in ENTREZGENE: MIR378-2 (accession: 100498808) |
| References |
| [1]Hossain MM, Ghanem N, Hoelker M, Rings F, Phatsara C, Tholen E, Schellander K, Tesfaye D, BMC Genomics. 10:443(2009)., "Identification and characterization of miRNAs expressed in the bovine ovary" |