| Basic information from miRBase |
| hairpin accession number: MI0009824 |
| Located between position 66042116 and 66042194 on chromosome 21 strand + |
| mature miRNAs for MI0009824: |
| bta-miR-409a (MIMAT0009310): AGGTTACCCGAGCAACTTTGCAT |
| You can find this miRNA in ENTREZGENE: MIR409 (accession: 100313377) |
| References |
| [1]Artzi S, Kiezun A, Shomron N, BMC Bioinformatics. 9:39(2008)., "miRNAminer: a tool for homologous microRNA gene search" |
| [2]Strozzi F, Mazza R, Malinverni R, Williams JL, Anim Genet. 40:125(2009)., "Annotation of 390 bovine miRNA genes by sequence similarity with other species" |
| [3]Jin W, Grant JR, Stothard P, Moore SS, Guan LL, BMC Mol Biol. 10:90(2009)., "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" |