miRNEST 2.0, an integrative microRNA resource

miRNEST 2.0, an integrative microRNA resource :: Browse

Basic information from miRBase

hairpin accession number: MI0005046

Located between position 21234483 and 21234576 on chromosome 19 strand +

Overlapping with sense strand of CCD55_BOVIN (intron 1).

(Ensemble: ENSBTAT00000025760)

mature miRNAs for MI0005046:

bta-miR-423-5p (MIMAT0012537): TGAGGGGCAGAGAGCGAGACTTT

bta-miR-423-3p (MIMAT0003831): AAGCTCGGTCTGAGGCCCCTCAGT

You can find this miRNA in ENTREZGENE: MIR423 (accession: 791045)

References

[1]Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP, Physiol Genomics. 29:35-43(2007)., "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues"

[2]Tesfaye D, Worku D, Rings F, Phatsara C, Tholen E, Schellander K, Hoelker M, Mol Reprod Dev. 76:665-677(2009)., "Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach"

[3]Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ, PLoS One. 4:e6349(2009)., "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection"