| Basic information from miRBase |
| hairpin accession number: MI0012212 |
| Located between position 446856 and 446951 on chromosome Un.004.53 strand - |
| Overlapping with sense strand of (exon 1). |
| (Ensemble: ENSBTAT00000050919) |
| mature miRNAs for MI0012212: |
| bta-miR-424 (MIMAT0013593): CAGCAGCAATTCATGTTTTGA |
| bta-miR-424* (MIMAT0015304): CAAAACGTGAGGCGCTGCTAT |
| You can find this miRNA in ENTREZGENE: MIR424 (accession: 100498845) |
| References |
| [1]Hossain MM, Ghanem N, Hoelker M, Rings F, Phatsara C, Tholen E, Schellander K, Tesfaye D, BMC Genomics. 10:443(2009)., "Identification and characterization of miRNAs expressed in the bovine ovary" |
| [2]Jin W, Grant JR, Stothard P, Moore SS, Guan LL, BMC Mol Biol. 10:90(2009)., "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" |