| Basic information from miRBase |
| hairpin accession number: MI0005047 |
| Located between position 51903218 and 51903304 on chromosome 22 strand + |
| Overlapping with sense strand of DALRD3 (intron 1). |
| (Ensemble: ENSBTAT00000025168) |
| mature miRNAs for MI0005047: |
| bta-miR-425-5p (MIMAT0003832): ATGACACGATCACTCCCGTTGA |
| bta-miR-425-3p (MIMAT0003833): ATCGGGAATGTCGTGTCCGCCC |
| You can find this miRNA in ENTREZGENE: MIR425 (accession: 791046) |
| References |
| [1]Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP, Physiol Genomics. 29:35-43(2007)., "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" |