| Basic information from miRBase |
| hairpin accession number: MI0009829 |
| Located between position 48593123 and 48593206 on chromosome 16 strand - |
| Overlapping with sense strand of (intron 1). |
| (Ensemble: ENSBTAT00000034047) |
| mature miRNAs for MI0009829: |
| bta-miR-429 (MIMAT0009315): TAATACTGTCTGGTAATGCCGT |
| You can find this miRNA in ENTREZGENE: MIR429 (accession: 100313047) |
| References |
| [1]Artzi S, Kiezun A, Shomron N, BMC Bioinformatics. 9:39(2008)., "miRNAminer: a tool for homologous microRNA gene search" |
| [2]Strozzi F, Mazza R, Malinverni R, Williams JL, Anim Genet. 40:125(2009)., "Annotation of 390 bovine miRNA genes by sequence similarity with other species" |
| [3]Jin W, Grant JR, Stothard P, Moore SS, Guan LL, BMC Mol Biol. 10:90(2009)., "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" |