| Basic information from miRBase |
| hairpin accession number: MI0009835 |
| Located between position 25597344 and 25597441 on chromosome 20 strand + |
| mature miRNAs for MI0009835: |
| bta-miR-449b (MIMAT0009321): AGGCAGTGTATTGTTAGCTGGC |
| You can find this miRNA in ENTREZGENE: MIR449B (accession: 100313050) |
| References |
| [1]Artzi S, Kiezun A, Shomron N, BMC Bioinformatics. 9:39(2008)., "miRNAminer: a tool for homologous microRNA gene search" |
| [2]Strozzi F, Mazza R, Malinverni R, Williams JL, Anim Genet. 40:125(2009)., "Annotation of 390 bovine miRNA genes by sequence similarity with other species" |