| Basic information from miRBase |
| hairpin accession number: MI0012213 |
| Located between position 440487 and 440568 on chromosome Un.004.53 strand - |
| Overlapping with sense strand of (exon 1). |
| (Ensemble: ENSBTAT00000042186) |
| mature miRNAs for MI0012213: |
| bta-miR-450 (MIMAT0003834): TTTTGCGATGTGTTCCTAATAT |
| You can find this miRNA in ENTREZGENE: MIR450-1 (accession: 100498806) |
| References |
| [1]Jin W, Grant JR, Stothard P, Moore SS, Guan LL, BMC Mol Biol. 10:90(2009)., "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" |