Basic information from miRBase |
hairpin accession number: MI0005879 |
Located between position 1879453 and 1879508 on chromosome X strand + |
Overlapping with sense strand of Y59E1B.1 (intron 1). |
(Ensemble: Y59E1B.1) WormBase: WormBase) |
mature miRNAs for MI0005879: |
cel-miR-1018 (MIMAT0005031): AGAGAGATCATTGGACTTACAG |
References |
[1]Ruby JG, Jan CH, Bartel DP, Nature. 448:83-86(2007)., "Intronic microRNA precursors that bypass Drosha processing" |
[2]Kato M, de Lencastre A, Pincus Z, Slack FJ, Genome Biol. 10:R54(2009)., "Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development" |
more data |
Data from CoGemiR |