miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0005881
Located between position 10047642 and 10047711 on chromosome III strand -
Overlapping with sense strand of T16G12.1 (exon 7).
(Ensemble: T16G12.1) WormBase: WormBase)
mature miRNAs for MI0005881:
         cel-miR-1020* (MIMAT0020356): GTAAGTGTTACAGAATAATCT
         cel-miR-1020 (MIMAT0005033): ATTATTCTGTGACACTTTCAG

References
[1]Ruby JG, Jan CH, Bartel DP, Nature. 448:83-86(2007)., "Intronic microRNA precursors that bypass Drosha processing"
[2]Kato M, de Lencastre A, Pincus Z, Slack FJ, Genome Biol. 10:R54(2009)., "Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development"
[3]Warf MB, Johnson WE, Bass BL, RNA. 17:563-577(2011)., "Improved annotation of C. elegans microRNAs by deep sequencing reveals structures associated with processing by Drosha and Dicer"


more data
Data from CoGemiR