miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0005900
Located between position 6435382 and 6435469 on chromosome X strand -
mature miRNAs for MI0005900:
         cel-miR-1022 (MIMAT0005523): AAGATCATTGTTAGGACGCCATC
         cel-miR-1022* (MIMAT0020357): ATGATAGTCCAATGATGATCCAGC

References
[1]Gu SG, Pak J, Barberan-Soler S, Ali M, Fire A, Zahler AM, RNA. 13:1492-1504(2007)., "Distinct ribonucleoprotein reservoirs for microRNA and siRNA populations in C. elegans"
[2]Kato M, de Lencastre A, Pincus Z, Slack FJ, Genome Biol. 10:R54(2009)., "Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development"
[3]Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW, Nat Struct Mol Biol. 17:173-179(2010)., "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans"
[4]Warf MB, Johnson WE, Bass BL, RNA. 17:563-577(2011)., "Improved annotation of C. elegans microRNAs by deep sequencing reveals structures associated with processing by Drosha and Dicer"


more data
Data from CoGemiR