| more data |
| Data from CoGemiR |
| Basic information from miRBase |
| hairpin accession number: MI0007985 |
| Located between position 12608608 and 12608697 on chromosome I strand + |
| mature miRNAs for MI0007985: |
| cel-miR-1823 (MIMAT0006590): TACTGGAAGTGTTTAGGAGTAA |
| References |
| [1]Zhang L, Ding L, Cheung TH, Dong MQ, Chen J, Sewell AK, Liu X, Yates JR 3rd, Han M, Mol Cell. 28:598-613(2007)., "Systematic identification of C. elegans miRISC proteins, miRNAs, and mRNA targets by their interactions with GW182 proteins AIN-1 and AIN-2" |
| [2]Kato M, de Lencastre A, Pincus Z, Slack FJ, Genome Biol. 10:R54(2009)., "Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development" |
| more data |
| Data from CoGemiR |