Basic information from miRBase |
hairpin accession number: MI0008196 |
Located between position 10600452 and 10600514 on chromosome I strand + |
Overlapping with sense strand of T22A3.5 (intron 6). |
(Ensemble: T22A3.5) WormBase: WormBase) |
mature miRNAs for MI0008196: |
cel-miR-1828 (MIMAT0006768): ACTGGAAGCATTTAAGTGATAGT |
References |
[1]Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N, Nat Biotechnol. 26:407-415(2008)., "Discovering microRNAs from deep sequencing data using miRDeep" |
more data |
Data from CoGemiR |