miRNEST 2.0, an integrative microRNA resource

miRNEST 2.0, an integrative microRNA resource :: Browse

Basic information from miRBase

hairpin accession number: MI0008199

Located between position 15236283 and 15236344 on chromosome X strand -

Overlapping with sense strand of F39B1.1 (intron 20).

(Ensemble: F39B1.1) WormBase: WormBase)

mature miRNAs for MI0008199:

cel-miR-1829c (MIMAT0006771): AAGCGAAATTCAAGATGGTTGTA

References

[1]Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N, Nat Biotechnol. 26:407-415(2008)., "Discovering microRNAs from deep sequencing data using miRDeep"

[2]Kato M, de Lencastre A, Pincus Z, Slack FJ, Genome Biol. 10:R54(2009)., "Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development"

[3]Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW, Nat Struct Mol Biol. 17:173-179(2010)., "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans"

more data

Data from CoGemiR