| more data |
| Data from CoGemiR |
| Basic information from miRBase |
| hairpin accession number: MI0008202 |
| Located between position 11829133 and 11829196 on chromosome III strand + |
| Overlapping with sense strand of C18D11.4.2 (intron 3). |
| (Ensemble: C18D11.4.2) WormBase: WormBase) |
| mature miRNAs for MI0008202: |
| cel-miR-1832 (MIMAT0006774): TGGGCGGAGCGAATCGATGAT |
| References |
| [1]Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N, Nat Biotechnol. 26:407-415(2008)., "Discovering microRNAs from deep sequencing data using miRDeep" |
| [2]Kato M, de Lencastre A, Pincus Z, Slack FJ, Genome Biol. 10:R54(2009)., "Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development" |
| more data |
| Data from CoGemiR |