| Basic information from miRBase |
| hairpin accession number: MI0010967 |
| Located between position 17092817 and 17092883 on chromosome IV strand - |
| Overlapping with sense strand of Y116A8C.27a (intron 2). |
| (Ensemble: Y116A8C.27a) WormBase: WormBase) |
| mature miRNAs for MI0010967: |
| cel-miR-1832b* (MIMAT0011449): CAGCGAATCGCTCGGCCCACTTT |
| cel-miR-1832b (MIMAT0011450): AGTGGGCAGAGCGATTCGCTGAT |
| References |
| [1]Kato M, de Lencastre A, Pincus Z, Slack FJ, Genome Biol. 10:R54(2009)., "Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development" |