miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0000004
Located between position 9372759 and 9372856 on chromosome I strand -
Overlapping with sense strand of F16A11.3c.1 (intron 5).
(Ensemble: F16A11.3c.1) WormBase: WormBase)
mature miRNAs for MI0000004:
         cel-miR-2* (MIMAT0020302): CATCAAAGCGGTGGTTGATGTG
         cel-miR-2 (MIMAT0000004): TATCACAGCCAGCTTTGATGTGC
You can find this miRNA in EMBL: (accession: AJ487557)

References
[1]Lau NC, Lim LP, Weinstein EG, Bartel DP, Science. 294:858-862(2001)., "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans"
[2]Lee RC, Ambros V, Science. 294:862-864(2001)., "An extensive class of small RNAs in Caenorhabditis elegans"
[3]Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP, Genes Dev. 17:991-1008(2003)., "The microRNAs of Caenorhabditis elegans"
[4]Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D, Curr Biol. 13:807-818(2003)., "MicroRNAs and other tiny endogenous RNAs in C. elegans"
[5]Grad Y, Aach J, Hayes GD, Reinhart BJ, Church GM, Ruvkun G, Kim J, Mol Cell. 11:1253-1263(2003)., "Computational and experimental identification of C. elegans microRNAs"
[6]Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP, Cell. 127:1193-1207(2006)., "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans"
[7]Kato M, de Lencastre A, Pincus Z, Slack FJ, Genome Biol. 10:R54(2009)., "Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development"
[8]Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW, Nat Struct Mol Biol. 17:173-179(2010)., "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans"
[9]Warf MB, Johnson WE, Bass BL, RNA. 17:563-577(2011)., "Improved annotation of C. elegans microRNAs by deep sequencing reveals structures associated with processing by Drosha and Dicer"


more data
Data from CoGemiR