miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0010974
Located between position 1390843 and 1390960 on chromosome X strand +
mature miRNAs for MI0010974:
         cel-miR-2221 (MIMAT0011463): CAAGTGATACCAGACCGCTAGT

References
[1]de Wit E, Linsen SE, Cuppen E, Berezikov E, Genome Res. 19:2064-2074(2009)., "Repertoire and evolution of miRNA genes in four divergent nematode species"