miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0000321
Located between position 7887365 and 7887461 on chromosome I strand +
mature miRNAs for MI0000321:
         cel-miR-245* (MIMAT0020336): GCTATTTGCAAGGTACCTAATTG
         cel-miR-245 (MIMAT0000301): ATTGGTCCCCTCCAAGTAGCTC
You can find this miRNA in WORMBASE: (accession: F55D12/9021-9117)

References
[1]Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP, Genes Dev. 17:991-1008(2003)., "The microRNAs of Caenorhabditis elegans"
[2]Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP, Cell. 127:1193-1207(2006)., "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans"
[3]Kato M, de Lencastre A, Pincus Z, Slack FJ, Genome Biol. 10:R54(2009)., "Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development"
[4]Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW, Nat Struct Mol Biol. 17:173-179(2010)., "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans"
[5]Warf MB, Johnson WE, Bass BL, RNA. 17:563-577(2011)., "Improved annotation of C. elegans microRNAs by deep sequencing reveals structures associated with processing by Drosha and Dicer"


more data
Data from CoGemiR