| more data |
| Data from CoGemiR |
| Basic information from miRBase |
| hairpin accession number: MI0000337 |
| Located between position 3306230 and 3306332 on chromosome II strand + |
| Overlapping with antisense strand of F39E9.7 (3UTR 3). |
| (Ensemble: F39E9.7) WormBase: WormBase) |
| mature miRNAs for MI0000337: |
| cel-miR-260 (MIMAT0000315): GTGATGTCGAACTCTTGTAG |
| You can find this miRNA in WORMBASE: (accession: F39E9/22318-22420) |
| References |
| [1]Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D, Curr Biol. 13:807-818(2003)., "MicroRNAs and other tiny endogenous RNAs in C. elegans" |
| [2]Kato M, de Lencastre A, Pincus Z, Slack FJ, Genome Biol. 10:R54(2009)., "Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development" |
| more data |
| Data from CoGemiR |