| more data |
| Data from CoGemiR |
| Basic information from miRBase |
| hairpin accession number: MI0000345 |
| Located between position 12740412 and 12740497 on chromosome IV strand - |
| Overlapping with sense strand of T23F6.5 (intron 1). |
| (Ensemble: T23F6.5) WormBase: WormBase) |
| mature miRNAs for MI0000345: |
| cel-miR-265 (MIMAT0000321): TGAGGGAGGAAGGGTGGTAT |
| References |
| [1]Grad Y, Aach J, Hayes GD, Reinhart BJ, Church GM, Ruvkun G, Kim J, Mol Cell. 11:1253-1263(2003)., "Computational and experimental identification of C. elegans microRNAs" |
| more data |
| Data from CoGemiR |