| more data |
| Data from CoGemiR |
| Basic information from miRBase |
| hairpin accession number: MI0000347 |
| Located between position 12638046 and 12638138 on chromosome II strand - |
| Overlapping with antisense strand of Y38E10A.18 (intron 6). |
| (Ensemble: Y38E10A.18) WormBase: WormBase) |
| mature miRNAs for MI0000347: |
| cel-miR-267 (MIMAT0000323): CCCGTGAAGTGTCTGCTGCA |
| References |
| [1]Grad Y, Aach J, Hayes GD, Reinhart BJ, Church GM, Ruvkun G, Kim J, Mol Cell. 11:1253-1263(2003)., "Computational and experimental identification of C. elegans microRNAs" |
| more data |
| Data from CoGemiR |