| Basic information from miRBase |
| hairpin accession number: MI0013633 |
| Located between position 6747121 and 6747181 on chromosome II strand + |
| Overlapping with sense strand of F41G3.5 (intron 2). |
| (Ensemble: F41G3.5) WormBase: WormBase) |
| mature miRNAs for MI0013633: |
| cel-miR-2953-5p (MIMAT0014446): TACAGAAGTGTTCGTGAAAAT |
| cel-miR-2953-3p (MIMAT0014447): GATCACTAGCTCTTCTGTAGC |
| References |
| [1]Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW, Nat Struct Mol Biol. 17:173-179(2010)., "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" |
| [2]Warf MB, Johnson WE, Bass BL, RNA. 17:563-577(2011)., "Improved annotation of C. elegans microRNAs by deep sequencing reveals structures associated with processing by Drosha and Dicer" |