| Basic information from miRBase |
| hairpin accession number: MI0017536 |
| Located between position 12346214 and 12346296 on chromosome II strand - |
| Overlapping with sense strand of C44C11.1a (intron 4). |
| (Ensemble: C44C11.1a) WormBase: WormBase) |
| mature miRNAs for MI0017536: |
| cel-miR-4806-5p (MIMAT0019988): CACTTACCGGCTGAGCCATGC |
| cel-miR-4806-3p (MIMAT0019989): ATAGCTCAGCCGGTAAGAGGC |
| References |
| [1]Jan CH, Friedman RC, Ruby JG, Bartel DP, Nature. 469:97-101(2011)., "Formation, regulation and evolution of Caenorhabditis elegans 3'UTRs" |