| Basic information from miRBase |
| hairpin accession number: MI0017539 |
| Located between position 1873641 and 1873699 on chromosome X strand + |
| Overlapping with sense strand of Y59E1B.2 (intron 2). |
| (Ensemble: Y59E1B.2) WormBase: WormBase) |
| mature miRNAs for MI0017539: |
| cel-miR-4809* (MIMAT0019993): GTAAGTTCAGAGTTGAATTATC |
| cel-miR-4809 (MIMAT0019994): TAATACAACTTCTGGGCTTCCAG |
| References |
| [1]Jan CH, Friedman RC, Ruby JG, Bartel DP, Nature. 469:97-101(2011)., "Formation, regulation and evolution of Caenorhabditis elegans 3'UTRs" |
| [2]Chung WJ, Agius P, Westholm JO, Chen M, Okamura K, Robine N, Leslie CS, Lai EC, Genome Res. 21:286-300(2011)., "Computational and experimental identification of mirtrons in Drosophila melanogaster and Caenorhabditis elegans" |