| Basic information from miRBase |
| hairpin accession number: MI0017542 |
| Located between position 15242695 and 15242770 on chromosome X strand - |
| Overlapping with sense strand of F39B1.1 (intron 7). |
| (Ensemble: F39B1.1) WormBase: WormBase) |
| mature miRNAs for MI0017542: |
| cel-miR-4812 (MIMAT0019998): AAGAGCGCTTGTAGTGAGTTGT |
| cel-miR-4812* (MIMAT0019999): CAACCACTGCAATTTCTCTAT |
| References |
| [1]Jan CH, Friedman RC, Ruby JG, Bartel DP, Nature. 469:97-101(2011)., "Formation, regulation and evolution of Caenorhabditis elegans 3'UTRs" |