| Basic information from miRBase |
| hairpin accession number: MI0017544 |
| Located between position 13728298 and 13728397 on chromosome III strand - |
| Overlapping with sense strand of W06F12.2a (intron 8). |
| (Ensemble: W06F12.2a) WormBase: WormBase) |
| mature miRNAs for MI0017544: |
| cel-miR-4814* (MIMAT0020002): TTCTCAACCAACTTTGGCCACT |
| cel-miR-4814 (MIMAT0020003): TGGGCAAAGTTGGTTGAGAAGT |
| References |
| [1]Jan CH, Friedman RC, Ruby JG, Bartel DP, Nature. 469:97-101(2011)., "Formation, regulation and evolution of Caenorhabditis elegans 3'UTRs" |