| Basic information from miRBase |
| hairpin accession number: MI0017545 |
| Located between position 5668906 and 5669004 on chromosome IV strand - |
| Overlapping with sense strand of T19E7.6.2 (intron 1). |
| (Ensemble: T19E7.6.2) WormBase: WormBase) |
| mature miRNAs for MI0017545: |
| cel-miR-4815 (MIMAT0020004): TGTATGAGCAAAATGCGAGGA |
| References |
| [1]Jan CH, Friedman RC, Ruby JG, Bartel DP, Nature. 469:97-101(2011)., "Formation, regulation and evolution of Caenorhabditis elegans 3'UTRs" |