| Basic information from miRBase |
| hairpin accession number: MI0017546 |
| Located between position 6185082 and 6185146 on chromosome I strand + |
| Overlapping with sense strand of T09B4.2.2 (intron 3). |
| (Ensemble: T09B4.2.2) WormBase: WormBase) |
| mature miRNAs for MI0017546: |
| cel-miR-4816 (MIMAT0020005): GTAAGTGGTTTTTGTAGATCAA |
| cel-miR-4816* (MIMAT0020006): ATCTACAATTTTCGCACTTACAG |
| References |
| [1]Jan CH, Friedman RC, Ruby JG, Bartel DP, Nature. 469:97-101(2011)., "Formation, regulation and evolution of Caenorhabditis elegans 3'UTRs" |
| [2]Chung WJ, Agius P, Westholm JO, Chen M, Okamura K, Robine N, Leslie CS, Lai EC, Genome Res. 21:286-300(2011)., "Computational and experimental identification of mirtrons in Drosophila melanogaster and Caenorhabditis elegans" |