| Basic information from miRBase |
| hairpin accession number: MI0017705 |
| Located between position 8133398 and 8133453 on chromosome IV strand - |
| Overlapping with sense strand of F42G8.11 (exon 2). |
| (Ensemble: F42G8.11) WormBase: WormBase) |
| mature miRNAs for MI0017705: |
| cel-miR-4920 (MIMAT0020126): GTAAGGAAAACTTTTGAATTT |
| References |
| [1]Chung WJ, Agius P, Westholm JO, Chen M, Okamura K, Robine N, Leslie CS, Lai EC, Genome Res. 21:286-300(2011)., "Computational and experimental identification of mirtrons in Drosophila melanogaster and Caenorhabditis elegans" |