| Basic information from miRBase |
| hairpin accession number: MI0017706 |
| Located between position 1879974 and 1880033 on chromosome X strand + |
| Overlapping with sense strand of Y59E1B.1 (intron 6). |
| (Ensemble: Y59E1B.1) WormBase: WormBase) |
| mature miRNAs for MI0017706: |
| cel-miR-4921 (MIMAT0020127): TGTGCCACTCACTTTCTTGCAG |
| References |
| [1]Chung WJ, Agius P, Westholm JO, Chen M, Okamura K, Robine N, Leslie CS, Lai EC, Genome Res. 21:286-300(2011)., "Computational and experimental identification of mirtrons in Drosophila melanogaster and Caenorhabditis elegans" |