| Basic information from miRBase |
| hairpin accession number: MI0017708 |
| Located between position 3304831 and 3304888 on chromosome V strand - |
| Overlapping with sense strand of F35F10.10 (intron 8). |
| (Ensemble: F35F10.10) WormBase: WormBase) |
| mature miRNAs for MI0017708: |
| cel-miR-4922 (MIMAT0020128): TATATAACTGTTCTATTCACAG |
| References |
| [1]Chung WJ, Agius P, Westholm JO, Chen M, Okamura K, Robine N, Leslie CS, Lai EC, Genome Res. 21:286-300(2011)., "Computational and experimental identification of mirtrons in Drosophila melanogaster and Caenorhabditis elegans" |