| Basic information from miRBase |
| hairpin accession number: MI0017710 |
| Located between position 10840835 and 10840888 on chromosome IV strand - |
| Overlapping with sense strand of T11G6.5b.1 (exon 7). |
| (Ensemble: T11G6.5b.1) WormBase: WormBase) |
| mature miRNAs for MI0017710: |
| cel-miR-4924 (MIMAT0020130): GTAAGTATCATCAATATTAATA |
| References |
| [1]Chung WJ, Agius P, Westholm JO, Chen M, Okamura K, Robine N, Leslie CS, Lai EC, Genome Res. 21:286-300(2011)., "Computational and experimental identification of mirtrons in Drosophila melanogaster and Caenorhabditis elegans" |