| Basic information from miRBase |
| hairpin accession number: MI0017714 |
| Located between position 3507189 and 3507244 on chromosome III strand - |
| Overlapping with sense strand of M01F1.4b (exon 7). |
| (Ensemble: M01F1.4b) WormBase: WormBase) |
| mature miRNAs for MI0017714: |
| cel-miR-4927 (MIMAT0020134): GTGGGTTTTTTCAAAATTTTTT |
| References |
| [1]Chung WJ, Agius P, Westholm JO, Chen M, Okamura K, Robine N, Leslie CS, Lai EC, Genome Res. 21:286-300(2011)., "Computational and experimental identification of mirtrons in Drosophila melanogaster and Caenorhabditis elegans" |