| Basic information from miRBase |
| hairpin accession number: MI0017715 |
| Located between position 13461663 and 13461772 on chromosome II strand - |
| Overlapping with sense strand of E01G4.3a.2 (intron 1). |
| (Ensemble: E01G4.3a.2) WormBase: WormBase) |
| mature miRNAs for MI0017715: |
| cel-miR-4929 (MIMAT0020135): AATGCACCACATCTTACGCTCA |
| References |
| [1]de Lencastre A, Pincus Z, Zhou K, Kato M, Lee SS, Slack FJ, Curr Biol. 20:2159-2168(2010)., "MicroRNAs both promote and antagonize longevity in C. elegans" |