| Basic information from miRBase |
| hairpin accession number: MI0017716 |
| Located between position 2398650 and 2398759 on chromosome IV strand + |
| Overlapping with antisense strand of Y38F2AR.10 (intron 3). |
| (Ensemble: Y38F2AR.10) WormBase: WormBase) |
| mature miRNAs for MI0017716: |
| cel-miR-4930 (MIMAT0020136): GGCTGCCTAGGGGGCTGGCTAG |
| References |
| [1]de Lencastre A, Pincus Z, Zhou K, Kato M, Lee SS, Slack FJ, Curr Biol. 20:2159-2168(2010)., "MicroRNAs both promote and antagonize longevity in C. elegans" |