Basic information from miRBase |
hairpin accession number: MI0017717 |
Located between position 2921187 and 2921291 on chromosome I strand + |
Overlapping with antisense strand of Y71F9AL.18.2 (intron 4). |
(Ensemble: Y71F9AL.18.2) WormBase: WormBase) |
mature miRNAs for MI0017717: |
cel-miR-4931 (MIMAT0020137): TCGCTGATTGGTTGAGCAGT |
References |
[1]de Lencastre A, Pincus Z, Zhou K, Kato M, Lee SS, Slack FJ, Curr Biol. 20:2159-2168(2010)., "MicroRNAs both promote and antagonize longevity in C. elegans" |