| Basic information from miRBase |
| hairpin accession number: MI0017721 |
| Located between position 18562443 and 18562552 on chromosome V strand + |
| Overlapping with antisense strand of Y51A2D.12 (intron 5). |
| (Ensemble: Y51A2D.12) WormBase: WormBase) |
| mature miRNAs for MI0017721: |
| cel-miR-4935 (MIMAT0020141): GCCGGCGAGAGAGGTGGAGAGCG |
| References |
| [1]de Lencastre A, Pincus Z, Zhou K, Kato M, Lee SS, Slack FJ, Curr Biol. 20:2159-2168(2010)., "MicroRNAs both promote and antagonize longevity in C. elegans" |