miRNEST 2.0, an integrative microRNA resource

miRNEST 2.0, an integrative microRNA resource :: Browse

Basic information from miRBase

hairpin accession number: MI0000026

Located between position 13144748 and 13144845 on chromosome X strand -

Overlapping with antisense strand of F09A5.3b (intron 1).

(Ensemble: F09A5.3b) WormBase: WormBase)

mature miRNAs for MI0000026:

cel-miR-55* (MIMAT0020313): CGGCAGAAACCTATCGGTTATA

cel-miR-55 (MIMAT0000026): TACCCGTATAAGTTTCTGCTGAG

You can find this miRNA in EMBL: (accession: AJ487579)

References

[1]Lau NC, Lim LP, Weinstein EG, Bartel DP, Science. 294:858-862(2001)., "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans"

[2]Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP, Genes Dev. 17:991-1008(2003)., "The microRNAs of Caenorhabditis elegans"

[3]Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D, Curr Biol. 13:807-818(2003)., "MicroRNAs and other tiny endogenous RNAs in C. elegans"

[4]Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP, Cell. 127:1193-1207(2006)., "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans"

[5]Kato M, de Lencastre A, Pincus Z, Slack FJ, Genome Biol. 10:R54(2009)., "Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development"

[6]Warf MB, Johnson WE, Bass BL, RNA. 17:563-577(2011)., "Improved annotation of C. elegans microRNAs by deep sequencing reveals structures associated with processing by Drosha and Dicer"

more data

Data from CoGemiR